Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 1531009
End position: 1531032
Length: 24

DNA sequence
>NC_007712, from 1531009 to 1531032 (24 bp); Sodalis glossinidius str. morsitans TCTTCATCGTCATATTCATCTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1530949-1531668	Sequence	SG0936 - hypothetical protein (Protein is coded in complementary strand; from 1531668 to 1530949)