Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 1753772
End position: 1753795
Length: 24

DNA sequence
>NC_007712, from 1753772 to 1753795 (24 bp); Sodalis glossinidius str. morsitans CCGCCGGCGCCGCCGCGGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1753709-1757272	Sequence	SG1052 rne ribonuclease E (Protein is coded in complementary strand; from 1757272 to 1753709)