Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 2735115
End position: 2735138
Length: 24

DNA sequence
>NC_007712, from 2735115 to 2735138 (24 bp); Sodalis glossinidius str. morsitans AGCAGCAGCACCAGCACCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2735007-2736539	Sequence	SG1590 - NADH dehydrogenase subunit M (Protein is coded in complementary strand; from 2736539 to 2735007)