Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 2774629
End position: 2774652
Length: 24

DNA sequence
>NC_007712, from 2774629 to 2774652 (24 bp); Sodalis glossinidius str. morsitans CCAGCACCATCAACAGCACCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2774208-2774870	Sequence	SG1618 - hypothetical protein (Protein is coded in complementary strand; from 2774870 to 2774208)