Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 3966174
End position: 3966197
Length: 24

DNA sequence
>NC_007712, from 3966174 to 3966197 (24 bp); Sodalis glossinidius str. morsitans TGGCGGTCTGGCGGTCTGGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3965830-3966696	Sequence	SG2307 - hypothetical protein (Protein is coded in complementary strand; from 3966696 to 3965830)