Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 3446988
End position: 3447017
Length: 30

DNA sequence
>NC_007712, from 3446988 to 3447017 (30 bp); Sodalis glossinidius str. morsitans GGCGACGGCGGGCGGCGGTGGGCTACAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3447011-3448747	Sequence	SG1991 - ssDNA exonuclease RecJ (Protein is coded in complementary strand; from 3448747 to 3447011)