Sequence retrieval

Genome: Sodalis glossinidius str. morsitans
Start position: 4013695
End position: 4013739
Length: 45

DNA sequence
>NC_007712, from 4013695 to 4013739 (45 bp); Sodalis glossinidius str. morsitans CGCAGTTGCCGCAGTTGCCGCAGTTGCCGCAGTTGCCGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4013055-4014932	Sequence	SG2337 - ATP-dependent DNA helicase RecQ (Protein is coded in complementary strand; from 4014932 to 4013055)