Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 1342856
End position: 1342885
Length: 30

DNA sequence
>NC_007796, from 1342856 to 1342885 (30 bp); Methanospirillum hungatei JF-1 AGTAGCAGTAGAAGTGGCAGCAGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1342843-1343100	Sequence	Mhun_1179 - H+-transporting two-sector ATPase, C subunit