Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 1392246
End position: 1392293
Length: 48

DNA sequence
>NC_007796, from 1392246 to 1392293 (48 bp); Methanospirillum hungatei JF-1 CCTTTCTCGATTCCTTTCTCGATTCCTTTCTCGATTCCTTTCTCGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1392129-1393163	Sequence	Mhun_1221 - hypothetical protein (Protein is coded in complementary strand; from 1393163 to 1392129)