Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 1396750
End position: 1396785
Length: 36

DNA sequence
>NC_007796, from 1396750 to 1396785 (36 bp); Methanospirillum hungatei JF-1 GTTTTCCTTCTTGTCTTCCTTCTTGTCTTCCTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1396617-1397636	Sequence	Mhun_1225 - hypothetical protein (Protein is coded in complementary strand; from 1397636 to 1396617)