Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 2075876
End position: 2075905
Length: 30

DNA sequence
>NC_007796, from 2075876 to 2075905 (30 bp); Methanospirillum hungatei JF-1 ATATTTTTTTATAAATTTTTTTATTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2075454-2075876	Sequence	Mhun_1842 - methyl-viologen-reducing hydrogenase subunit delta