Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 2169371
End position: 2169394
Length: 24

DNA sequence
>NC_007796, from 2169371 to 2169394 (24 bp); Methanospirillum hungatei JF-1 TGGTTTTGCTTTTGGTTGTGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2168550-2169551	Sequence	Mhun_1927 - hypothetical protein (Protein is coded in complementary strand; from 2169551 to 2168550)