Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 2733770
End position: 2733793
Length: 24

DNA sequence
>NC_007796, from 2733770 to 2733793 (24 bp); Methanospirillum hungatei JF-1 ACATTGACATTGACCTTGACTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2732687-2733961	Sequence	Mhun_2459 - thiamine biosynthesis protein ThiC (Protein is coded in complementary strand; from 2733961 to 2732687)