Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 3304337
End position: 3304360
Length: 24

DNA sequence
>NC_007796, from 3304337 to 3304360 (24 bp); Methanospirillum hungatei JF-1 AGTCGGAGTAGGGGTCGGTGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3304134-3305189	Sequence	Mhun_3033 - hypothetical protein (Protein is coded in complementary strand; from 3305189 to 3304134)