Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 428617
End position: 428640
Length: 24

DNA sequence
>NC_007796, from 428617 to 428640 (24 bp); Methanospirillum hungatei JF-1 AACAAAAATAAAAACCAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 428466-429857	Sequence	Mhun_0388 - polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 429857 to 428466)