Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 563030
End position: 563053
Length: 24

DNA sequence
>NC_007796, from 563030 to 563053 (24 bp); Methanospirillum hungatei JF-1 CACTCCAACTCCCAGTCCGACTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 561376-563604	Sequence	Mhun_0486 - peptidase S8/S53 subtilisin kexin sedolisin