Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 646248
End position: 646272
Length: 25

DNA sequence
>NC_007796, from 646248 to 646272 (25 bp); Methanospirillum hungatei JF-1 CGTCCCGTGCTGTCCCGTCCCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 645479-646627	Sequence	Mhun_0557 - ATP-NAD/AcoX kinase (Protein is coded in complementary strand; from 646627 to 645479)