Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 869519
End position: 869563
Length: 45

DNA sequence
>NC_007796, from 869519 to 869563 (45 bp); Methanospirillum hungatei JF-1 ACAAATTCCATGTTTACAAATTCCATGTTTACAAATTCCATGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 869313-869582	Sequence	Mhun_0750 - hypothetical protein (Protein is coded in complementary strand; from 869582 to 869313)