Sequence retrieval

Genome: Methanospirillum hungatei JF-1
Start position: 923104
End position: 923128
Length: 25

DNA sequence
>NC_007796, from 923104 to 923128 (25 bp); Methanospirillum hungatei JF-1 ATGATATGATATGGTATGAAAAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 923129-924025	Sequence	Mhun_0813 - radical SAM family protein (Protein is coded in complementary strand; from 924025 to 923129)