Sequence retrieval

Genome: Chlamydophila felis Fe_C-56
Start position: 158238
End position: 158267
Length: 30

DNA sequence
>NC_007899, from 158238 to 158267 (30 bp); Chlamydophila felis Fe_C-56 TGCTTTAGCTTTTGGTTTAGCTTTAGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 158152-158532	Sequence	CF0133 hctA histone H1-like protein Hc1 (Protein is coded in complementary strand; from 158532 to 158152)