Sequence retrieval

Genome: Chlamydophila felis Fe_C-56
Start position: 93376
End position: 93399
Length: 24

DNA sequence
>NC_007899, from 93376 to 93399 (24 bp); Chlamydophila felis Fe_C-56 AGCTAAAGCAAAAGCTAAACCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 92915-94144	Sequence	CF0084 brnQ branched-chain amino acid transport system carrier protein (Protein is coded in complementary strand; from 94144 to 92915)