Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1202680
End position: 1202703
Length: 24

DNA sequence
>NC_007908, from 1202680 to 1202703 (24 bp); Rhodoferax ferrireducens T118 GGTGGCGGCGGCGGTGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1202236-1202895	Sequence	Rfer_1117 - hypothetical protein (Protein is coded in complementary strand; from 1202895 to 1202236)