Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1770952
End position: 1770975
Length: 24

DNA sequence
>NC_007908, from 1770952 to 1770975 (24 bp); Rhodoferax ferrireducens T118 GGCGCTCAGGCGTTCAGGCGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1770966-1772066	Sequence	Rfer_1640 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 1772066 to 1770966)