Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1911709
End position: 1911732
Length: 24

DNA sequence
>NC_007908, from 1911709 to 1911732 (24 bp); Rhodoferax ferrireducens T118 CAGCCCCAGCACCAGGCCCAGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1911185-1912069	Sequence	Rfer_1776 - binding-protein-dependent transport systems inner membrane component (Protein is coded in complementary strand; from 1912069 to 1911185)