Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1974946
End position: 1974969
Length: 24

DNA sequence
>NC_007908, from 1974946 to 1974969 (24 bp); Rhodoferax ferrireducens T118 GCACCACCACCAGCGCCAGTACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1973520-1975466	Sequence	Rfer_1836 - ABC transporter-like protein (Protein is coded in complementary strand; from 1975466 to 1973520)