Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1997603
End position: 1997626
Length: 24

DNA sequence
>NC_007908, from 1997603 to 1997626 (24 bp); Rhodoferax ferrireducens T118 GTGGCCATGGCCGTGGCGGTGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1996497-1997675	Sequence	Rfer_1855 - binding-protein-dependent transport systems inner membrane component