Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3000002
End position: 3000025
Length: 24

DNA sequence
>NC_007908, from 3000002 to 3000025 (24 bp); Rhodoferax ferrireducens T118 TGGAGGTGAAGGTGTAGGTGTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2999086-3001476	Sequence	Rfer_2719 - hemolysin-type calcium-binding protein (Protein is coded in complementary strand; from 3001476 to 2999086)