Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3073562
End position: 3073585
Length: 24

DNA sequence
>NC_007908, from 3073562 to 3073585 (24 bp); Rhodoferax ferrireducens T118 CGTTGGCATTGGCGGTGGCGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3073396-3074964	Sequence	Rfer_2785 mdoG glucan biosynthesis protein G (Protein is coded in complementary strand; from 3074964 to 3073396)