Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3118000
End position: 3118023
Length: 24

DNA sequence
>NC_007908, from 3118000 to 3118023 (24 bp); Rhodoferax ferrireducens T118 CCAGCACCACCACCAGCGCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3117534-3118370	Sequence	Rfer_2816 - enoyl-CoA hydratase/isomerase (Protein is coded in complementary strand; from 3118370 to 3117534)