Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3201162
End position: 3201185
Length: 24

DNA sequence
>NC_007908, from 3201162 to 3201185 (24 bp); Rhodoferax ferrireducens T118 GCGTCAGCGTCAGCGTTAGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3200700-3204197	Sequence	Rfer_2896 - UvrD/REP helicase (Protein is coded in complementary strand; from 3204197 to 3200700)