Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3451665
End position: 3451688
Length: 24

DNA sequence
>NC_007908, from 3451665 to 3451688 (24 bp); Rhodoferax ferrireducens T118 GAGCGCCGCAGCGCCGGAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3451333-3451962	Sequence	Rfer_3113 - lysine exporter protein LysE/YggA (Protein is coded in complementary strand; from 3451962 to 3451333)