Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3504242
End position: 3504265
Length: 24

DNA sequence
>NC_007908, from 3504242 to 3504265 (24 bp); Rhodoferax ferrireducens T118 GGCGTTGGCATTGCCGTTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3503888-3504937	Sequence	Rfer_3167 - hypothetical protein (Protein is coded in complementary strand; from 3504937 to 3503888)