Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3628821
End position: 3628844
Length: 24

DNA sequence
>NC_007908, from 3628821 to 3628844 (24 bp); Rhodoferax ferrireducens T118 GGTGGCGGTGGCGGTGGCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3628689-3631229	Sequence	Rfer_3271 - hypothetical protein (Protein is coded in complementary strand; from 3631229 to 3628689)