Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 4173897
End position: 4173920
Length: 24

DNA sequence
>NC_007908, from 4173897 to 4173920 (24 bp); Rhodoferax ferrireducens T118 CCAGCACCACCAGCAGCATCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4173101-4173967	Sequence	Rfer_3741 - nitrate transport permease (Protein is coded in complementary strand; from 4173967 to 4173101)