Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 970946
End position: 970969
Length: 24

DNA sequence
>NC_007908, from 970946 to 970969 (24 bp); Rhodoferax ferrireducens T118 CAAGGACAGGGACAAGGACAAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 968817-971000	Sequence	Rfer_0922 - multi-sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 971000 to 968817)