Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 981874
End position: 981897
Length: 24

DNA sequence
>NC_007908, from 981874 to 981897 (24 bp); Rhodoferax ferrireducens T118 CACCAGCACCAGCGCCAGCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 981479-982318	Sequence	Rfer_0932 - binding-protein-dependent transport systems inner membrane component (Protein is coded in complementary strand; from 982318 to 981479)