Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 2117483
End position: 2117507
Length: 25

DNA sequence
>NC_007908, from 2117483 to 2117507 (25 bp); Rhodoferax ferrireducens T118 TGGTTTGGTTTGGTTTGGATTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2116953-2117516	Sequence	Rfer_1970 - GrpE protein (Protein is coded in complementary strand; from 2117516 to 2116953)