Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1214451
End position: 1214477
Length: 27

DNA sequence
>NC_007908, from 1214451 to 1214477 (27 bp); Rhodoferax ferrireducens T118 GCCCATGCCGCCCATGCCGCCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1214446-1216104	Sequence	Rfer_1131 groEL chaperonin GroEL (Protein is coded in complementary strand; from 1216104 to 1214446)