Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1882879
End position: 1882905
Length: 27

DNA sequence
>NC_007908, from 1882879 to 1882905 (27 bp); Rhodoferax ferrireducens T118 TGCTACCCATGCTGCCCATGCCACCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1882251-1882997	Sequence	Rfer_1746 - PE-PGRS family protein (Protein is coded in complementary strand; from 1882997 to 1882251)