Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 205915
End position: 205941
Length: 27

DNA sequence
>NC_007908, from 205915 to 205941 (27 bp); Rhodoferax ferrireducens T118 CAAGGCGGCCAACGCGGCCAAGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 205907-206689	Sequence	Rfer_0207 - 16S ribosomal RNA methyltransferase RsmE (Protein is coded in complementary strand; from 206689 to 205907)