Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 3179506
End position: 3179533
Length: 28

DNA sequence
>NC_007908, from 3179506 to 3179533 (28 bp); Rhodoferax ferrireducens T118 AGCCGCTGGCCGCTCGCCGCTGGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3178796-3179740	Sequence	Rfer_2876 - polyprenyl synthetase (Protein is coded in complementary strand; from 3179740 to 3178796)