Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 4552955
End position: 4552990
Length: 36

DNA sequence
>NC_007908, from 4552955 to 4552990 (36 bp); Rhodoferax ferrireducens T118 CCAGGGGCACCAGGAGCACCAGGGGCGCCAGGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4550312-4553122	Sequence	Rfer_4080 - hypothetical protein (Protein is coded in complementary strand; from 4553122 to 4550312)