Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 580964
End position: 581008
Length: 45

DNA sequence
>NC_007908, from 580964 to 581008 (45 bp); Rhodoferax ferrireducens T118 CCAAACCTGACGCAGCCAAGCCCGACGCCGTCAAACTTGACGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 580958-581557	Sequence	Rfer_0556 - flagellar basal body-associated protein FliL