Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1486097
End position: 1486150
Length: 54

DNA sequence
>NC_007908, from 1486097 to 1486150 (54 bp); Rhodoferax ferrireducens T118 CGGAGTCAGAAGCAGAAGCAGAAGCAGAAGCAGAAGCAGAAGCAGAAGCAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1482881-1488547	Sequence	Rfer_1375 - CheA signal transduction histidine kinase