Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 2098621
End position: 2098674
Length: 54

DNA sequence
>NC_007908, from 2098621 to 2098674 (54 bp); Rhodoferax ferrireducens T118 GGCTACTTTCTTAGCCGGAGCGACTTTCTTGGCCGGCGCTACTTTTTTAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2098280-2098714	Sequence	Rfer_1954 - SWIB/MDM2 (Protein is coded in complementary strand; from 2098714 to 2098280)