Sequence retrieval

Genome: Rhodoferax ferrireducens T118
Start position: 1857838
End position: 1857897
Length: 60

DNA sequence
>NC_007908, from 1857838 to 1857897 (60 bp); Rhodoferax ferrireducens T118 CCACGTCCGTCACCACGTCCGTCACCACGTCCGTCACCACGTCCGTCACCACGTCCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1856782-1859805	Sequence	Rfer_1720 - ribonuclease (Protein is coded in complementary strand; from 1859805 to 1856782)