Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 1001994
End position: 1002017
Length: 24

DNA sequence
>NC_007955, from 1001994 to 1002017 (24 bp); Methanococcoides burtonii DSM 6242 TTCAACTTCAATTTTAACATCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1000459-1002198	Sequence	Mbur_0930 - hypothetical protein (Protein is coded in complementary strand; from 1002198 to 1000459)