Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 1645110
End position: 1645136
Length: 27

DNA sequence
>NC_007955, from 1645110 to 1645136 (27 bp); Methanococcoides burtonii DSM 6242 CCGACCTGACCAACCTGACCGACCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1644789-1645430	Sequence	Mbur_1567 - hypothetical protein (Protein is coded in complementary strand; from 1645430 to 1644789)