Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 2335225
End position: 2335254
Length: 30

DNA sequence
>NC_007955, from 2335225 to 2335254 (30 bp); Methanococcoides burtonii DSM 6242 CCATATCCGTATCCATACCCATATCCGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2334769-2335647	Sequence	Mbur_2222 - hypothetical protein (Protein is coded in complementary strand; from 2335647 to 2334769)