Sequence retrieval

Genome: Methanococcoides burtonii DSM 6242
Start position: 265591
End position: 265620
Length: 30

DNA sequence
>NC_007955, from 265591 to 265620 (30 bp); Methanococcoides burtonii DSM 6242 ATGACCTTGCGTGACCTTTCAAGACCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 264595-265764	Sequence	Mbur_0289 - aminotransferase, class V (Protein is coded in complementary strand; from 265764 to 264595)